Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 5496590
End position: 5496613
Length: 24

DNA sequence
>NC_014323, from 5496590 to 5496613 (24 bp); Herbaspirillum seropedicae SmR1 ACAGCAACACCAACAGCGGCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5495783-5496694	Sequence	Hsero_4791 - permease (Protein is coded in complementary strand; from 5496694 to 5495783)