Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 5198959
End position: 5198994
Length: 36

DNA sequence
>NC_014323, from 5198959 to 5198994 (36 bp); Herbaspirillum seropedicae SmR1 GTGGAAGCCGGGGAAGCCGGGGAAGCCGAGGAAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5198860-5200653	Sequence	Hsero_4538 tsr methyl-accepting chemotaxis transducer transmembrane protein (Protein is coded in complementary strand; from 5200653 to 5198860)