Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 5150684
End position: 5150710
Length: 27

DNA sequence
>NC_014323, from 5150684 to 5150710 (27 bp); Herbaspirillum seropedicae SmR1 GCTGTGGCCGCTGTGGCTGCCGTGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5149868-5151025	Sequence	Hsero_4501 pbpG D-alanyl-D-alanine carboxypeptidase (Protein is coded in complementary strand; from 5151025 to 5149868)