Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 5106090
End position: 5106113
Length: 24

DNA sequence
>NC_014323, from 5106090 to 5106113 (24 bp); Herbaspirillum seropedicae SmR1 CGTGGCCGTGACCGTGGGCGTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5103325-5106666	Sequence	Hsero_4466 - hemagglutinin-related protein (Protein is coded in complementary strand; from 5106666 to 5103325)