Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 5079505
End position: 5079531
Length: 27

DNA sequence
>NC_014323, from 5079505 to 5079531 (27 bp); Herbaspirillum seropedicae SmR1 GTTCATGCTGCTCATGCTGCTCATGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 5078501-5079529	Sequence	Hsero_4444 - sugar ABC transporter permease (Protein is coded in complementary strand; from 5079529 to 5078501)
ORF... 5079526-5080584	Sequence	Hsero_4445 - sugar ABC transporter permease (Protein is coded in complementary strand; from 5080584 to 5079526)