Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 5078133
End position: 5078156
Length: 24

DNA sequence
>NC_014323, from 5078133 to 5078156 (24 bp); Herbaspirillum seropedicae SmR1 GGCGGCGACGGCGGCGGCGACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5076754-5078190	Sequence	Hsero_4442 fucK L-fuculokinase (Protein is coded in complementary strand; from 5078190 to 5076754)