Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 5072612
End position: 5072647
Length: 36

DNA sequence
>NC_014323, from 5072612 to 5072647 (36 bp); Herbaspirillum seropedicae SmR1 CCCCCCTGTCATCCCCCCTGTCATCCCTCCTGTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 5072645-5073568	Sequence	Hsero_4438 - LysR family transcription regulator protein (Protein is coded in complementary strand; from 5073568 to 5072645)