Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 4961697
End position: 4961720
Length: 24

DNA sequence
>NC_014323, from 4961697 to 4961720 (24 bp); Herbaspirillum seropedicae SmR1 TCGGCCACGGCCTCGGCCTGGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4960704-4962143	Sequence	Hsero_4335 thdF tRNA modification (thiophene/furan oxidation) GTPase (Protein is coded in complementary strand; from 4962143 to 4960704)