Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 4654893
End position: 4654922
Length: 30

DNA sequence
>NC_014323, from 4654893 to 4654922 (30 bp); Herbaspirillum seropedicae SmR1 AACTAGAAGAAACTAGAAGAAACCAGCAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4654906-4655427	Sequence	Hsero_4058 tatB Sec-independent protein translocase (Protein is coded in complementary strand; from 4655427 to 4654906)