Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 4613202
End position: 4613237
Length: 36

DNA sequence
>NC_014323, from 4613202 to 4613237 (36 bp); Herbaspirillum seropedicae SmR1 GTGCTCGACCTGCTGCTCGACCTGGCGCTCGATCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4612489-4613997	Sequence	Hsero_4023 - sugar ABC transporter ATPase (Protein is coded in complementary strand; from 4613997 to 4612489)