Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 4607509
End position: 4607541
Length: 33

DNA sequence
>NC_014323, from 4607509 to 4607541 (33 bp); Herbaspirillum seropedicae SmR1 GGTCCCTGCACTGTCCCTGCACTGTCCCTGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 4607025-4607510	Sequence	Hsero_4017 - MarR family transcription regulator protein