Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 4207986
End position: 4208012
Length: 27

DNA sequence
>NC_014323, from 4207986 to 4208012 (27 bp); Herbaspirillum seropedicae SmR1 GTGGACCCGGTGGACCCGGTGGACTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4207146-4208057	Sequence	Hsero_3673 - SIR2 family NAD-dependent deacetylase 3 protein (Protein is coded in complementary strand; from 4208057 to 4207146)