Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 4207059
End position: 4207094
Length: 36

DNA sequence
>NC_014323, from 4207059 to 4207094 (36 bp); Herbaspirillum seropedicae SmR1 CCAGGCCTATGCCCAGGGCTTTGCCCACGCCTTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4205582-4207216	Sequence	Hsero_3672 - major facilitator superfamily permease