Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 4148912
End position: 4148941
Length: 30

DNA sequence
>NC_014323, from 4148912 to 4148941 (30 bp); Herbaspirillum seropedicae SmR1 GGGATCAGCCTGGATCGGCCGGGATCAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4148917-4149660	Sequence	Hsero_3616 ugpQ glycerophosphoryl diester phosphodiesterase (Protein is coded in complementary strand; from 4149660 to 4148917)