Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 4139316
End position: 4139351
Length: 36

DNA sequence
>NC_014323, from 4139316 to 4139351 (36 bp); Herbaspirillum seropedicae SmR1 GCTCCTGCTCTTGTCCCTGCTCTTGTCCCTGCTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4138895-4139959	Sequence	Hsero_3608 - transcription regulator protein (Protein is coded in complementary strand; from 4139959 to 4138895)