Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 405691
End position: 405738
Length: 48

DNA sequence
>NC_014323, from 405691 to 405738 (48 bp); Herbaspirillum seropedicae SmR1 TTGGCGGCTGCCTTGGGCGCTGCCTTAGCGGCGGCCTTGGGGGCTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 405313-405840	Sequence	Hsero_0372 - hypothetical protein (Protein is coded in complementary strand; from 405840 to 405313)