Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 3945483
End position: 3945506
Length: 24

DNA sequence
>NC_014323, from 3945483 to 3945506 (24 bp); Herbaspirillum seropedicae SmR1 GATCAGGAACAGGATCAGGAACAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3944950-3945591	Sequence	Hsero_3439 dedA DedA transmembrane protein (Protein is coded in complementary strand; from 3945591 to 3944950)