Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 3821537
End position: 3821563
Length: 27

DNA sequence
>NC_014323, from 3821537 to 3821563 (27 bp); Herbaspirillum seropedicae SmR1 GCGCAAGCCGCGCAGGCCGCGCAAGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3821193-3821723	Sequence	Hsero_3332 - hypothetical protein (Protein is coded in complementary strand; from 3821723 to 3821193)