Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 3802036
End position: 3802059
Length: 24

DNA sequence
>NC_014323, from 3802036 to 3802059 (24 bp); Herbaspirillum seropedicae SmR1 GGCATCAGGGCGTCAGCGCATCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3802057-3802818	Sequence	Hsero_3315 phaB 3-ketoacyl-ACP reductase (Protein is coded in complementary strand; from 3802818 to 3802057)