Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 3520211
End position: 3520255
Length: 45

DNA sequence
>NC_014323, from 3520211 to 3520255 (45 bp); Herbaspirillum seropedicae SmR1 ATTCGGCTTATCCGGCTTATCCGGCTTATCCGGCTTATCCGGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3520255-3521091	Sequence	Hsero_3064 - GntR family transcriptional regulator (Protein is coded in complementary strand; from 3521091 to 3520255)