Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 3412049
End position: 3412072
Length: 24

DNA sequence
>NC_014323, from 3412049 to 3412072 (24 bp); Herbaspirillum seropedicae SmR1 TCTGCATCTGCTCCTGCATCTGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3411979-3412545	Sequence	Hsero_2997 phbF polybetahydroxybutyrate accumulation regulatory protein PhbF (Protein is coded in complementary strand; from 3412545 to 3411979)