Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 3278594
End position: 3278629
Length: 36

DNA sequence
>NC_014323, from 3278594 to 3278629 (36 bp); Herbaspirillum seropedicae SmR1 TGGCGCACTTACTGGCGCACTTATTGGCGCAATTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3276165-3279584	Sequence	Hsero_2882 - hemolysin-type calcium binding protein (Protein is coded in complementary strand; from 3279584 to 3276165)