Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 3100470
End position: 3100505
Length: 36

DNA sequence
>NC_014323, from 3100470 to 3100505 (36 bp); Herbaspirillum seropedicae SmR1 CAGCGCCGCGCCCAGCGCTGCGGCCAGCACCACGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3099772-3100644	Sequence	Hsero_2720 - high-affinity Fe2+/Pb2+ permease (Protein is coded in complementary strand; from 3100644 to 3099772)