Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 3077954
End position: 3077980
Length: 27

DNA sequence
>NC_014323, from 3077954 to 3077980 (27 bp); Herbaspirillum seropedicae SmR1 TGATCAGAATGACCAGAATGATCCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3077936-3078589	Sequence	Hsero_2702 - transcription regulator protein (Protein is coded in complementary strand; from 3078589 to 3077936)