Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 3035111
End position: 3035146
Length: 36

DNA sequence
>NC_014323, from 3035111 to 3035146 (36 bp); Herbaspirillum seropedicae SmR1 TGGTCATGGTCATGGTCATGGTCATGGTCATGGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3032990-3037183	Sequence	Hsero_2657 cobN cobalamin biosynthesis protein (Protein is coded in complementary strand; from 3037183 to 3032990)