Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 2919204
End position: 2919239
Length: 36

DNA sequence
>NC_014323, from 2919204 to 2919239 (36 bp); Herbaspirillum seropedicae SmR1 GAAGCGGCGGAAGCGGCAGAAGCGGAGGAAGCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2917995-2919290	Sequence	Hsero_2560 - aspartate/tyrosine/aromatic aminotransferase (Protein is coded in complementary strand; from 2919290 to 2917995)