Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 2687399
End position: 2687431
Length: 33

DNA sequence
>NC_014323, from 2687399 to 2687431 (33 bp); Herbaspirillum seropedicae SmR1 TAGTCCTTGCTCGGTCCTTGCTCAGTCATTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2685720-2687402	Sequence	Hsero_2349 pvdE siderophore (cyclic peptide) ABC transporter protein