Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 2515888
End position: 2515911
Length: 24

DNA sequence
>NC_014323, from 2515888 to 2515911 (24 bp); Herbaspirillum seropedicae SmR1 GCGCCAGCGCCCGGGCCAGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2515278-2516357	Sequence	Hsero_2232 - ABC transporter ATPase (Protein is coded in complementary strand; from 2516357 to 2515278)