Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 250166
End position: 250192
Length: 27

DNA sequence
>NC_014323, from 250166 to 250192 (27 bp); Herbaspirillum seropedicae SmR1 TGGCTCATGTGGCTCATGTGGCTCATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 248933-250174	Sequence	Hsero_0244 lldD FMN-dependent L-lactate dehydrogenase (Protein is coded in complementary strand; from 250174 to 248933)