Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 2444092
End position: 2444136
Length: 45

DNA sequence
>NC_014323, from 2444092 to 2444136 (45 bp); Herbaspirillum seropedicae SmR1 GATGTCCTCGGCGACGATGTCCACGCCGGCGATGTCCAGGCCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2443181-2445379	Sequence	Hsero_2171 cphA1 cyanophycin synthetase (Protein is coded in complementary strand; from 2445379 to 2443181)