Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 2323075
End position: 2323098
Length: 24

DNA sequence
>NC_014323, from 2323075 to 2323098 (24 bp); Herbaspirillum seropedicae SmR1 GCTGCGGCAGCGGCGGCGGCTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2322901-2324610	Sequence	Hsero_2059 - hypothetical protein (Protein is coded in complementary strand; from 2324610 to 2322901)