Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 2321469
End position: 2321492
Length: 24

DNA sequence
>NC_014323, from 2321469 to 2321492 (24 bp); Herbaspirillum seropedicae SmR1 GGCCAGGTCCAGCGCCAGGTCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2321158-2321859	Sequence	Hsero_2057 fliH flagellar assembly protein FliH (Protein is coded in complementary strand; from 2321859 to 2321158)