Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 2281857
End position: 2281883
Length: 27

DNA sequence
>NC_014323, from 2281857 to 2281883 (27 bp); Herbaspirillum seropedicae SmR1 GGAGTGATGGGTGTGATGGGTGTGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2281390-2282379	Sequence	Hsero_2017 czcD Co/Zn/Cd efflux system component protein (Protein is coded in complementary strand; from 2282379 to 2281390)