Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 2253506
End position: 2253532
Length: 27

DNA sequence
>NC_014323, from 2253506 to 2253532 (27 bp); Herbaspirillum seropedicae SmR1 CCTGGCCATCCTGCCCATGCTGGCCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2252662-2254098	Sequence	Hsero_1994 epsM cholera toxin secretion EpsM protein