Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 2191208
End position: 2191231
Length: 24

DNA sequence
>NC_014323, from 2191208 to 2191231 (24 bp); Herbaspirillum seropedicae SmR1 GCTTCGGCTTCCGCTGCGGCTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2190206-2191999	Sequence	Hsero_1934 lepA GTP-binding elongation factor protein