Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 2060539
End position: 2060562
Length: 24

DNA sequence
>NC_014323, from 2060539 to 2060562 (24 bp); Herbaspirillum seropedicae SmR1 CGAGATCGACATCGAGACCGAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2060364-2060816	Sequence	Hsero_1824 ibpA molecular chaperone (16 kDa) heat shock protein A