Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 2030217
End position: 2030240
Length: 24

DNA sequence
>NC_014323, from 2030217 to 2030240 (24 bp); Herbaspirillum seropedicae SmR1 GCTTGCTTGCCTGCTTGCTTACTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2030236-2032146	Sequence	Hsero_1801 htpG HSP90 family high temperature molecular chaperone G protein (Protein is coded in complementary strand; from 2032146 to 2030236)