Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 1961912
End position: 1961935
Length: 24

DNA sequence
>NC_014323, from 1961912 to 1961935 (24 bp); Herbaspirillum seropedicae SmR1 GGTGCAGGGGCAGGGGCAGGGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1961222-1962100	Sequence	Hsero_1732 - hypothetical protein (Protein is coded in complementary strand; from 1962100 to 1961222)