Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 1826504
End position: 1826536
Length: 33

DNA sequence
>NC_014323, from 1826504 to 1826536 (33 bp); Herbaspirillum seropedicae SmR1 TTAATGATGACTCAGTGATGACTCAGTGATGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1826527-1827915	Sequence	Hsero_1601 copA multicopper oxidase (Protein is coded in complementary strand; from 1827915 to 1826527)