Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 1824358
End position: 1824399
Length: 42

DNA sequence
>NC_014323, from 1824358 to 1824399 (42 bp); Herbaspirillum seropedicae SmR1 CAGCAAGCAGAAATCAGCAAGCAGAAATCAGCAAGCAGAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1824400-1826037	Sequence	Hsero_1599 alkK medium-chain-fatty-acid--CoA ligase (Protein is coded in complementary strand; from 1826037 to 1824400)