Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 1794176
End position: 1794202
Length: 27

DNA sequence
>NC_014323, from 1794176 to 1794202 (27 bp); Herbaspirillum seropedicae SmR1 GGATCAGCATGATCAGCAGGATCAGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1793752-1794441	Sequence	Hsero_1559 - metal ion ABC transporter permease (Protein is coded in complementary strand; from 1794441 to 1793752)