Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 1746389
End position: 1746415
Length: 27

DNA sequence
>NC_014323, from 1746389 to 1746415 (27 bp); Herbaspirillum seropedicae SmR1 GGCATCATCGGCATCATCGGCATCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1743666-1746812	Sequence	Hsero_1521 - cation/multidrug efflux pump transmembrane protein