Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 1739868
End position: 1739891
Length: 24

DNA sequence
>NC_014323, from 1739868 to 1739891 (24 bp); Herbaspirillum seropedicae SmR1 GGGGCTGGTGCTGGGACTGGGACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1738777-1740174	Sequence	Hsero_1517 envZ two component sensor histidine kinase (Protein is coded in complementary strand; from 1740174 to 1738777)