Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 1660271
End position: 1660297
Length: 27

DNA sequence
>NC_014323, from 1660271 to 1660297 (27 bp); Herbaspirillum seropedicae SmR1 AGATCAATATGATCAATACGATCAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1660293-1661363	Sequence	Hsero_1444 ansB L-asparaginase/archaeal Glu-tRNAGln amidotransferase subunit D protein (Protein is coded in complementary strand; from 1661363 to 1660293)