Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 1318578
End position: 1318610
Length: 33

DNA sequence
>NC_014323, from 1318578 to 1318610 (33 bp); Herbaspirillum seropedicae SmR1 GTGGCCTGATCGTGCTCTGATCGTGGCCTGATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1317295-1318587	Sequence	Hsero_1153 - major facilitator superfamily permease