Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 1232075
End position: 1232098
Length: 24

DNA sequence
>NC_014323, from 1232075 to 1232098 (24 bp); Herbaspirillum seropedicae SmR1 CCGCCGCCGCCGCCACCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1208609-1232659	Sequence	Hsero_1088 - hypothetical protein (Protein is coded in complementary strand; from 1232659 to 1208609)