Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 1098324
End position: 1098359
Length: 36

DNA sequence
>NC_014323, from 1098324 to 1098359 (36 bp); Herbaspirillum seropedicae SmR1 CCATGCCACCCATGCCGCCCATACCACCCATGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1098311-1099960	Sequence	Hsero_0996 groEL1 chaperonin GroEL (Protein is coded in complementary strand; from 1099960 to 1098311)