Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 1040381
End position: 1040404
Length: 24

DNA sequence
>NC_014323, from 1040381 to 1040404 (24 bp); Herbaspirillum seropedicae SmR1 GTGGCGGTGGCGGCGGCGGTGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1038344-1040491	Sequence	Hsero_0948 fhuA TonB-dependent siderophore receptor protein (Protein is coded in complementary strand; from 1040491 to 1038344)