Sequence retrieval

Genome: Leuconostoc gasicomitatum LMG 18811
Start position: 689788
End position: 689823
Length: 36

DNA sequence
>NC_014319, from 689788 to 689823 (36 bp); Leuconostoc gasicomitatum LMG 18811 CATTAATATTAAGCTTAATATTAAAATTAATGTTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 689003-689842	Sequence	LEGAS_0673 - putative acyltransferase (Protein is coded in complementary strand; from 689842 to 689003)