Sequence retrieval

Genome: Leuconostoc gasicomitatum LMG 18811
Start position: 1640704
End position: 1640738
Length: 35

DNA sequence
>NC_014319, from 1640704 to 1640738 (35 bp); Leuconostoc gasicomitatum LMG 18811 CTAACCTTACCTAACCTATCCTTACCTAACCTAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1640326-1641135	Sequence	LEGAS_1609 - prophage protein (Protein is coded in complementary strand; from 1641135 to 1640326)